The Sequencing Reservoir is composed of a quartz sequencing substrate, a top reservoir piece, and bottom reservoir piece. The top and bottom pieces are made of polycarbonate with an over-molded TPE gasket that comes into contact with the quartz sequencing substrate. The bottom gasket allows the objective lens and camera sensor to capture images of sequencing in real-time as Lightning Terminators™ are incorporated on the top side of the sequencing substrate. The top piece of the sequencing reservoir forms the sequencing reaction vessel, and the top gasket seals the sequencing substrate to prevent leaks. The area bounded by the top gasket is covered in surface-bound forward and reverse primers. There is no exchange of fluid or cycling required for our truly one pot sequencing.
1 - Sequencing substrate preparation
Substrate preparation
Introduction
This protocol details materials and methods used to clean and activate quartz substrates for Sequencing Reservoirs.
The quartz substrates go through three stages of cleaning prior to activation: solvent, alkaline, and then an acid clean. Next, the clean slides are activated with piranha acid.
Commercially available MCP4 polymer is deposited on the surface of the activated substrate to provide a three dimensional layer of active NHS groups for oligonucleotide attachment.
Oligonucleotides with 5’ amine modifications are coupled to the slide surface. After blocking, washing, and drying the slides, they are ready to be assembled into Sequencing Reservoirs.
Assembled sequencing Reservoir with forward and reverse surface primers immobilized to sequencing substrate Created with BioRender.com and used with permission
Revision History
Document
Version Number
Date
Description of Change
Sequencing substrate preparation
V1.0
01/2024
Original document -KF
Materials and Equipment
Material or Reagent
Supplier
Order Information
Polished 10±0.1 x 10±0.1 x 0.5 mm Z-Cut Quartz
UQG Optics
custom part
Semiconductor grade 99.5% Isopropanol Alcohol
VWR
BDH2027
Semiconductor grade acetone
VWR
BDH2025
Semiconductor grade methanol
VWR
BDH2029
Reagent alcohol
VWR
BDH1156
deionized or 18.2MΩ water
various, in-house system ideal
n/a
Potassium Hydroxide
Spectrum Chemical
P1325
Hydrochloric acid (1N)
Sigma Aldrich
1506961000
Sulfuric acid (5M)
Sigma Aldrich
1.60315.1000
Hydrogen peroxide (30%)
BeanTown Chemical
219920
MCP4 Kit: 5x Coat on Coating Solution, MCP4 Polymer Concentrate, Spot on Spotting Solution, 2x Block on Blocking Solution
Handle organic solvents, strong bases, and acids with extreme caution, prioritizing safety at all times. Utilize appropriate personal protective equipment, including goggles and gloves, maintain workspaces well-ventilated or equipped with fume hoods, and strictly adhere to established protocols for storage, handling, and disposal.
NHS esters in aqueous solution will undergo hydrolysis. Do not allow MCP4 working solution to sit unused once polymer is added. Ensure MCP4 coated slides are washed aggressively after coating to remove uncoupled polymer without over exposing to water.
Procedure
1. Clean Z-Cut Quartz Slides
Solvent clean
Submerge slides vertically in a bath of semiconductor grade acetone
Sonicate 5 minutes
Transfer slides to a bath of semiconductor grade isopropyl alcohol
Sonicate 5 minutes
Transfer slides to a bath of methanol
Sonicate 5 minutes
Alkaline clean
Transfer slides to a bath of 10% potassium hydroxide in methanol (% w/v)
Sonicate 20 minutes at 50º C
Transfer slides to a bath of reagent alcohol
Sonicate for 20 minutes at 50º C
Repeat steps 1.2.1 through 1.2.2 for a total of two potassium hydroxide and two reagent alcohol washes
Transfer slides to a water bath
Sonicate for 5 minutes
Transfer slides to a new water bath
Repeat steps 1.2.4 through 1.2.5 for a total of 3 washes with sonication
Transfer slides to a methanol bath
Sonicate for 5 minutes
Acid clean
Transfer slides into a fresh bath containing a solution of 50% hydrochloric acid in methanol
Sonicate for 30 minutes at 60º C
Transfer slides to a water bath
Sonicate for 5 min.
Repeat step 1.3.2 two more times for a total of three washes, using a fresh water bath for each wash
Dry slides thoroughly with filtered compressed nitrogen
Any residual moisture will dry onto slide, TIRF system is very sensitive to any residue, debris, or dried material on slide surface
Store until ready to proceed to acid cleaning step
Safe stopping point
Slides can be stored dry in desiccator for many weeks.
2. Piranha activate clean slides
Transfer slides to a bath containing piranha acid
Prepare piranha acid by combining 1 volume 30% hydrogen peroxide to 3 volumes of 5 M sulfuric acid
Sonicate for 60 min at 60º C.
Transfer slides into a water bath
Sonicate for 5 min.
Repeat step 2.2 four times for a total of 5 water washes with sonication, using a fresh water bath each time
Ensure all traces of piranha acid are removed
Dry slides thoroughly with filtered compressed nitrogen
Any residual moisture will dry onto slide, TIRF system is very sensitive to any residue, debris, or dried material on slide surface
Keep going
Proceed immediately to MCP4 Polymer Deposition
3. MCP4 polymer deposition
Prepare MCP4 working solution by combining the following reagents:
Note: DO NOT add polymer to solution until slides are ready for incubation
Incubate activated slides in MCP4 Working Solution for 30 minutes
Slides can be submerged or assembled in fixtures that allow for a pool of working solution to cover a desired area
After incubation, slides need to be aggressively washed in deionized water
Submerge in running 5 minutes, or submerge in multiple passive baths of deionized water. If slides are assembled in fixtures, recommend disassembling and washing an addition 1-3 minutes vertically in running water.
Dry slides thoroughly with filtered compressed nitrogen
Any residual moisture will dry onto slide, TIRF system is very sensitive to any residue, debris, or dried material on slide surface
Cure dry slides at 80º C under high vacuum
Keep going
Proceed immediately to oligo immobilization
4. Oligo immobilization
Prepare a 250 uM each solution of forward and reverse surface primers in nuclease free water
Concentrations can be optimized experimentally
Determine ideal spotting conditions for your DNA microarray printer
Surface primer solution can be diluted 1:1 with Spot on Spotting Solution when ready to spot primers onto surface
Incubate slides overnight
Keep going
Proceed to slide blocking, washing, and drying
5. Blocking, washing, drying
Prepare 1x Block on Blocking solution by diluting stock 1:1 in nuclease free water
Fill vertical reaction chambers with 270-300 uL of solution
Transfer slides from overnight incubation into the pre-filled reaction chamber
Incubate at 50 C for 30 minutes
Place slides vertically in a deionized water bath
Incubate 5 min in running water
Transfer slides to a 2x SSC + 0.1% SDS solution and incubate 10 minutes with enough shaking to agitate the solution without dislodging slides
Place slides vertically in a deionized water bath
Incubate 5 min in running water
Dry slides thoroughly with filtered compressed nitrogen
Any residual moisture will dry onto slide, TIRF system is very sensitive to any residue, debris, or dried material on slide surface
Safe stopping point
Slides can be stored dry in desiccator or used directly for assembling sequencing reservoir.
The assembly station is constructed on a solid heavy base to prevent movement during assembly. The design above is just a typical example and requires 4 appropriately spaced M5 tapped holes.
Procedure
Place the Reservoir Assembly Jig Vacuum base on the heavy base and secure with two M5 screws (91292A192).
Place the 3D printed Reservoir Centering Fixture on top of the Vacuum base and secure it with two M5 screws (91292A193).
Screw the push-to-connect elbow fitting (5779K652) into the back port (1/8 NPT).
Hook up the venturi pump with and appropriately valved air valve and place the O-ring in the center of the Vacuum Jig base (9262K421).
The system is ready to be used for the assembly of the reservoirs.
3 - Sequencing reservoir assembly
Reservoir Assembly
Introduction
This protocol details materials and methods to assemble Sequencing Reservoirs. The reservoir is composed of three major parts: reservoir Top, reservoir Bottom, and sealed in between the two, the sequencing substrate coated in immobilized surface primers.
A vacuum fixture is used to hold the reservoir bottom in place as the sequencing substrate is aligned on top of the gasket of the reservoir bottom. Once well aligned, the vacuum is turned on and will hold the slide firmly to the gasket. The gasketed surface of the reservoir top is then placed on top of the slide, and force is applied to lock the reservoir top legs into the reservoir bottom. Looking down into the reservoir through the top reveals about 20 mm² of the sequencing substrate. The top surface of the substrate is covered in immobilized surface primers and ready for sequencing library hybridization.
A press is used to compress the whole assembled sequencing reservoir to help ensure there are no leaks during subsequent steps.
Sequencing substrates and reservoir tops and bottoms should remain particle free. Components should be stored in clean air tight containers when not in use. For manipulation it is recommended to work in a clean room and/or within a laminar flow hood. All materials for reservoir assembly should be placed within clean space before starting procedure.
Procedure
1. Assemble Reservoir
Place reservoir bottom onto the vacuum block with the TPU gasket facing up and the elevated legs in the top left and bottom right corners
Using tweezers, carefully place the slide onto the bottom part of the reservoir with the oligo coated side facing up
Use tweezers to gently manipulate slide so it is centered over the reservoir bottom
Turn the vacuum on so the slide and bottom reservoir are help in place for next steps. Ensure slide is still centered over reservoir bottom
Screw on a cap to the reservoir top
Hold the reservoir top over the slide and reservoir bottom so the longer legs are positioned over the longer leg inserts of the reservoir bottom
Longer pieces of both parts should be at the top left and bottom right corners
Once properly positioned, carefully lower reservoir top onto reservoir bottom so the legs are resting on the leg inserts
Depress forcefully to finish assembling the reservoir
Listen for two audible “clicks” as the reservoir top is fitted into the reservoir bottom
2. Check assembly
Turn off vacuum holding reservoir in place and remove assembled reservoir
Inspect edges of glass slide to ensure it is still well centered between top and bottom pieces and there are no corners or sides protruding
Inspect gasket to slide contact of top and bottom pieces ensures there are no gaps between glass and gaskets
3. Press assembled reservoir to prevent leaking
Place reservoir cap-down in reservoir press fixture
Turn on press and wait 5 seconds
Turn off press and remove reservoir
Label reservoir for your experiment
Safe stopping point
Assembled reservoirs can be stored dry at room temperature for weeks to months
4 - Linear DISCS preparation
DISCS Preparation
Introduction
454’s One Pot Sequencing relies on the 365nm UV TIRF to deblock Lightning Terminator dye linked terminator groups. Stray UV light also deblocks the free Lightning Terminators™ in the bulk solution. The resulting deprotected dNTP competes with LTs during incorporation by Therminator and causes significant leading.
We have developed DISCS (Dark Base In-Situ Cleanup System): which includes Bst 3.0 DNA polymerase from NEB and a set of duplex oligos to quickly consume the deblocked dNTP (dark bases). DISCS is crucial for the success of One Pot Sequencing.
This protocol describes the procedure to prepare linear DISCS for one pot sequencing.
Revision History
Document
Version Number
Date
Description of Change
DISCS
V1.0
Jan 2024
original JW
Materials and Equipment
Item
Vendor
Cat. No
ThermoPol Buffer, 10x
NEB
B9004S
IDTE, pH 8.0
IDT
11-05-01-09
A_DISC_F
IDT
AAAAAACTATGACCGTGATTAGGCCAAGCTCGCACG
A_DISC_R
IDT
AAAAAACGTGCGAGCTTGGCCTAATCACGGTCATAG
C_DISC_F
IDT
AAACCCCTATGACCGTGATTAGGCCAAGCTCGCACG
C_DISC_R
IDT
AAACCCCGTGCGAGCTTGGCCTAATCACGGTCATAG
G_DISC_F
IDT
AAAGGGCTATGACCGTGATTAGGCCAAGCTCGCACG
G_DISC_R
IDT
AAAGGGCGTGCGAGCTTGGCCTAATCACGGTCATAG
T_DISC_F
IDT
AAATTTCTATGACCGTGATTAGGCCAAGCTCGCACG
T_DISC_R
IDT
AAATTTCGTGCGAGCTTGGCCTAATCACGGTCATAG
Water, nuclease free
IDT
11-05-01-04
Thermal cycler
various
n/a
Pipettes and tips (200 uL, 20 uL, 2 uL)
various
n/a
Procedure
Resuspend fresh oligo pellets from IDT with IDTE to 200 uM stock concentration.