With the LED-TIRF Transformer built and the Sequencing Reservoir consumable assembled, you are ready to begin sequencing!
The first step to sequencing is to prepare a sequencing library. This entails taking your DNA sequence of interest and adding specific known DNA sequences to it. This process allows you to sequence your unknown sequence of interest on the Transformer.
The library molecules will all contain the complement to the surface-bound forward primer on the sequencing substrate. This allows each molecule to hybridize to the sequencing substrate so a polymerase can initiate surface amplified cluster generation.
Library molecules also contain the surface-bound reverse primer sequence. As forward strands are generated using the library molecules as template, the complement of the surface-bound reverse primer is polymerized so the surface-bound reverse primers can anneal and a polymerase can extend reverse strands. As more copies of forward and reverse strands are produced branching off of the surface and the growing cluster, the cluster becomes hyperbranched.
Another important library element is the site for the sequencing primer. The hyperbranched surface amplified clusters will contain a primer binding site just upstream of the DNA sequence of interest. When you’re ready to sequence, the sequencing primer will anneal to this site. The first base extended from this sequencing primer will be the first base of your DNA of interest.
1 - Library preparation
Library preparation
Introduction
This protocol details methods to prepare circular single stranded DNA library using 5’ phosphorylated synthetic linear ssDNA as starting material (synthetic library). Oligonucleotides can be ordered from IDT, resuspended, and used directly in CircLigase reaction to produce synthetic library.
Library insert size is critical to success using the TIRF Transformer system and rolling circle surface amplification (RCA). Template copy number in sequencing clusters is highly dependent on insert length. Longer insert translates to lower copy number in RCA generated sequencing clusters, and consequently, reduced signal upon Lightning Terminator incorporation.
Revision history
Document
Version number
Date
Description of change
Library preparation
v1.0
12/2023
Original document -KF
Materials and equipment
Material or Reagent
Vendor
Order Information
Link
Synthetic Library Molecule: /5Phos/AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT< insert >ATCTCGTATGCCGTCTTCTGCTTG *where < insert > is your DNA sequence of interest. for getting your system going, we recomend at least 4 16-nt templates with high diversity at each position
Various- Qubit ssDNA kit, for example. Not needed for A260 quantitation
n/a
n/a
Equipment
Vendor
Thermocycler
Various
Vortex
Various
Mini centrifuge
Various
PCR tube magnet stand
Various
UV/Vis system or Fluorometer for DNA quantitation
Various
P-1000 pipette and filtered tips
Various
P-200 pipette and filtered tips
Various
Optional: P-20 and/or P-10 pipette and filtered tips
Various
1.5 mL nuclease free tubes
Various
Nuclease free PCR tubes
Various
Notes before starting
Consider insert length when designing synthetic library molecules as longer inserts will compromise sequencing quality (lower signal per cluster). We have achieved good results with 16 nt inserts.
CircLigase efficiency decreases with templates greater than 100 nt. We have achieved good results with templates from 85 to about 300 nt.
Exonuclease treated CircLigase products are cleaned up using Ampure XP beads. Alternative purification methods suitable for single stranded circular DNA can be substituted.
Procedure
1. Prepare materials
Resuspend or dilute synthetic templates to 100 µM in nuclease free H₂O
Optional: prepare aliquots to minimize freeze-thaw cycles
Optional: Pool synthetic templates to reduce number of circularization reactions
Combine equal volumes of each 100 µM template (minimum of 4 µL required per reaction for next steps)
2. Circularization of synthetic templates
Prepare one new, clean PCR tube per circularization reaction
One reaction should produce ample material for hundreds of sequencing reactions
Templates can be pooled or circularized individually
Load the following program on a thermocycler:
Temperature
Time
60 ºC
16 hours
80 ºC
10 minutes
Prepare CircLigase Reaction Mix by combining the following components in order on ice using the tubes prepared in step 2.1:
Reagent
Volume for 1 reaction
Final concentration
Nuclease free water
13 µL
Circligase buffer, 10x
2 µL
1x
MnCl₂, 50 mM
1 µL
2.5 mM
ATP, 1 mM
1 µL
50 µM
Synthetic template(s), 100 µM total
2 µL
10 µM total
CircLigase I
1 µL
5 U/µL
Total volume
20 µL
Vortex and spin down reaction mix
Load tubes onto thermocycler and run the program loaded in step 2.2
3. Exonuclease cleanup
Optional: Prepare linear controls with and without exonuclease treatment:
Transfer 18 µL of 1x CutSmart buffer or 1x CircLigase buffer into two tubes, one labeled -exo and one labeled +exo
Add 2 µL of the 100 µM linear synthetic templates used in circularization reaction to each of the two tubes
Prepare exonuclease mixture:
Combine 1 µL Exonuclease I and 1 µL Exonuclease III in a tube per reaction on ice
Note: exonuclease III is only needed for templates with secondary structure and/or contaminating double stranded DNA
Vortex and spin down
Add two µL of exonuclease mixture to each CircLigase reaction and +exo linear control tube on ice. Pipette up and down to rinse tip after dispensing mixture
Vortex each reaction mix and spin down
Load the following program on a thermocycler:
Temperature
Time
37 ºC
40 minutes
80 ºC
20 minutes
4 ºC
forever
Load samples on thermocycler and run the program loaded in step 3.4
4. Library purification: 1.2x ampure cleanup
Prepare materials:
Allow Ampure XP beads to come to room temperature for 15-30 minutes
Prepare a fresh 80% absolute ethanol solution by combining 200 µL molecular biology grade absolute ethanol with 50 µL of nuclease free water per sample
Vortex Ampure XP beads aggressively to ensure beads are resuspended in a homogenous solution
Label one clean, new PCR tube per sample for the final elution step
Dispense 26 µL well mixed Ampure XP beads into each sample, pipetting up and down at least ten times to mix beads with sample
Pipette slowly and carefully, bead mixture is viscous
Incubate samples with beads on benchtop for 5 minutes
After 5 minute incubation, place samples on magnet stand and allow beads to pellet for 5 minutes
Using a p-100 or p-200 pipette, remove supernatant from each sample tube while on magnet stand, leaving behind beads pelleted to tube wall
Ethanol wash:
Dispense 100 µL 80% ethanol solution into each sample tube
Rotate tube 180º in magnet stand
Once beads have pelleted on the tube wall again, carefully remove supernatant
Repeat ethanol wash (step 4.6) again for a total of two washes
Dry beads:
After removing supernatant from the second wash, spin tubes down and replace on magnet stand with caps open
Using a p-10 pipette, remove any excess ethanol solution
Leave caps open and allow beads to dry for 3-5 minutes
Beads are sufficiently dry when pellet goes from a shiny to matte finish. Beads are overly dry if bead pellet begins to crack
Elute DNA
Once beads are dry and any ethanol has evaporated off, dispense 30 µL of nuclease free H₂O or low TE buffer onto bead pellets
Vortex each sample to ensure beads are in solution and not stuck to sides of tube
Quickly spin down to bring liquid to bottom of tube without pelleting beads
Incubate samples on benchtop (not magent) for 2 minutes
Replace samples on magnet and allow beads to pellet for 2 minutes
Carefully transfer supernatant containing DNA into the new, clean tubes prepared in step 4.1.4.
Beads can be discarded
5. Library quantitation and quality check
Determine library concentration in ng/µL
Libraries can be quantitated using fluorometric (Qubit ssDNA kit or other similar) or A260 (Nanodrop or similar)
Using library concentration and known size of synthetic templates, determine molarity (nM)
The +exo control tube should not have any DNA
6. Libraries can be aliquoted and stored at -20º C
Libraries can be diluted to 1 nM before aliquoting for long term storage
2 - Surface amplification
Surface amplification
Introduction
This protocol describes the materials and methods to generate surface amplified sequencing clusters on a reservoir.
Circular single stranded library hybridizes to surface immobilized forward primers. These primers initiate rolling circle amplification (RCA) to generate sequencing clusters. The forward strands produced will contain sequences which will anneal to the surface immobilized reverse primers. These primers are extended to produce reverse strands. Hyperbranched clusters are produced by forward and reverse RCA products annealing to the surface primers and initiating polymerization of more forward and reverse products.
Once hyperbranched clusters are generated by RCA, Thermolabile USER II is used to cleave the reverse strands from the surface. After denaturing and washing, the sequencing reservoir surface contains thousands of forward strand RCA clusters.
Since the TIRF system is highly sensitive to any incorporation at the sequencing reservoir surface, TdT is used to terminate all remaining 3’ ends after USER treatment. After a last set of denature and wash steps, the surface amplified clusters on the reservoir surface are ready to be sequenced on the LED-TIRF Transformer.
Hybridize library to sequencing substrate
Generate surface amplified sequencing clusters using Rolling Circle Amplification
Optimal circular library hybridization concentration is critical to achieving a high density of sequencing clusters without compromising monoclonality. We have achieved good results hybridizing clusters at concentrations of 0.15-0.4 pM, but ideal concentrations should be determined empirically.
Sodium hydroxide dilutions should be made fresh for same day use.
Procedure
1. Prepare reservoir for hybridization
Dispense 100 µL nuclease free (NF) H₂O into a new reservoir, being careful not to contact glass surface at bottom of reservoir
Aspirate and discard the liquid from the reservoir with P-100 or P-200 pipette by tilting the reservoir opening towards you and carefully placing the tip of the pipette at the lowest edge of the reservoir
2. Hybridize library
Dilute library to loading concentration
Library should be at 0.15 - 0.4 pM in 2x SSC + 0.1% Triton X 100 (SSCT)
Ensure there is at least 100 µL of diluted library per reservoir
Dispense 100 µL diluted library into reservoir
Incubate reservoir at 65º C for 4 minutes, 40º C for 44 minutes, and then room temperature for 4 minutes
After final 4 minute room temperature incubation, remove and discard 100 µL solution from reservoir
Dispense 50 µL of 1x RCA Buffer into reservoir
Safe stopping point
Proceed to cluster generation within 1 day. Reservoir can be stored at room temperature.
3. Cluster generation
Make Phi29XT Reaction Mix using the table below, adding each component in order:
Reagent
Volume for 1 reservoir
Final concentration
Nuclease free water
60 µL
Phi29-XT Reaction Buffer, 5x
20 µL
1x
dNTP Solution Mix, 10 mM
10 µL
1 mM
Phi29XT Polymerase, 10x
10 µL
1x
Total volume
100 µL
Vortex and spin down reaction mix, keep on ice
Remove 1x RCA buffer from sequencing reservoir by tilting reservoir towards you and aspirating at the lowest edge of the reservoir with a p-100 or p-200 pipette
Dispense 50 µL of the Phi29XT Reaction Mix into the reservoir
Ensure liquid is at bottom of reservoir
Store remaining reaction mix at 4º C for a reaction refresh
Incubate reservoir at 42º C for 30 minutes
Refresh Phi29XT Reaction Mix:
After 30 minutes, remove 20 µL of Phi29XT Reaction Mix from reservoir
Dispense the 50 µL of Phi29XT Reaction Mix remaining from step 3.3.2 into the reservoir and gently swirl
Ensure all liquid is at bottom of reservoir and incubate at 42º C for an additional 2 hours
After 2 hour incubation, proceed directly to step 4
4. Cleave reverse strands
Begin incubating the reservoir with Phi29XT Reaction Mix at 37º C
Dispense 2 µL of Thermolabile USER II enzyme into the reaction mix, pipetteing up and down to ensure full volume is dispensed
Tilt the reservoir towards you and use a P-100 or P-200 pipette set to 50 µL to gently and carefully mix the liquid without contacting the bottom surface of reservoir
Incubate the reservoir at 37º C for 30 minutes
4.5. After 30 minutes, remove the reaction mix
Denature reverse strands
Dispense 100 µL of 100 mM NaOH into reservoir
Incubate 3 minutes at room temperature
Remove NaOH from reservoir
Rinse reservoir:
Dispense 200 µL NF H₂O into reservoir
Pipette up and down 3 times to agitate the surface of the reservoir with the liquid
Remove NF H₂O
Repeat step 4.6.3 two times for a total of three rinses
Dispense 100 µL of 2x SSC + 0.1% Triton X 100 into reservoir
Safe stopping point
Reservoir can be stored at room temperature.
5. Block surface
Albumin blocking:
Prepare albumin blocking solution using the table below:
Reagent
Volume for 1 reservoir
Final concentration
Nuclease free water
42.5 µL
Terminal Transferase Buffer, 10x
5 µL
1x
Recombinant Albumin, 20 mg/mL
2.5 µL
1.12 mg/mL
Total volume
50 µL
Vortex and spin down mixture
Remove liquid from reservoir
Dispense 50 µL of albumin blocking solution into reservoir
Incubate 10 minutes at room temperature
3’ end blocking:
Prepare terminal transferase (TdT) Reaction Mixture using table below:
Reagent
Volume for 1 reservoir
Final concentration
Nuclease free water
35 µL
Terminal Transferase Buffer, 10x
5 µL
1x
CoCl₂, 10x
5 µL
1x
Dideoxynucleotide Solution, 2.5 mM (0.625 mM each ddATP, ddCTP, ddGTP, ddTTP)
4 µL
0.2 mM
Terminal Transferase, 20,000 U/mL
1 µL
400 U/mL
Total volume
50 µL
Vortex and spin down mixture
Remove albumin blocking solution from reservoir
Dispense 50 µL TdT Reaction Mixture into reservoir
Ensure all liquid is at bottom of reservoir
Incubate at 37º C for 30 minutes
Denature protein and rinse reservoir
Remove reaction mix from reservoir
Dispense 100 µL of 100 mM NaOH into reservoir
Incubate 3 minutes at room temperature
Remove NaOH from reservoir
Rinse reservoir:
Dispense 200 µL NF H₂O into reservoir
Pipette up and down 3 times to agitate the surface of the reservoir with the liquid
Remove NF H₂O
Repeat step 5.3.4 two times for a total of three rinses
Dispense 100 µL of 2x SSC + 0.1% Triton X 100 into reservoir
Safe stopping point
Reservoir can be stored at room temperature, or proceed to sequencing protocol.
3 - Sequencing
Sequencing starts now
Introduction
Traditional Sequencing By Synthesis technologies typically involve separate incorporation, washing, imaging, and cleavage steps with continuous feeding of multiple buffers. 454 Bio’s One Pot sequencing on the LED-TIRF based Transformer only needs one solution without any fluid exchange for imaging, washing, or cleaving steps.
One Pot Sequencing on the LED-TIRF Transformer takes place at a constant temperature of 58 C. A cycle of sequencing consists of a 10 minute incubation to allow for Lightning Terminator incorporation. Next, the 4 visible wavelength LEDs are pulsed to excite each Lightning Terminator. Images are captured in real time. After images are taken to record which base was incorporated, the Lightning Terminators™ are photocleaved by the UV LED. The linked dyes on incorporated Lightning Terminators™ are cleaved and diffuse away, allowing for the next base incorporation. This process is repeated for each cycle of sequencing.
This protocol describes the procedure to set up One Pot Sequencing on the LED-TIRF Transformer.
Lightning Terminators™ need to be carefully handled and only exposed to shorter than 500 nm light. Care should be taken to protect Lightning Terminators™ from photobleaching and from photocleaving due to exposure to light.
Enter the required information based on your experiment plan.
Retrieve OPB buffer, Seq Primer, LTMix, DISCS from -20°C freezer and thaw them by leaving them on the bench for 30 minutes at room temperature.
Pre-heat Transformer to 65°C.
Seq Primer Hybridization:
Prepare sequencing primer hybridization solution following the worksheet.
Add 120 µL hybridization solution into the sequencing reservoir.
Load the reservoir onto the pre-heated 454 Bio Transformer.
Incubate reservoir at 65°C for 10 minutes.
Bring the reservoir to the bench and incubate at room temperature for 10 minutes
Set Transformer temperature to 58°C for sequencing.
Rinse reservoir with 120 µL OPB once.
Therminator Preloading:
This step can be skipped if circular DISCS or RNA DISCS is used.
Prepare Therminator solution following the worksheet.
Add 60 µL Therminator solution into the reservoir.
Incubate for 3 minutes at room temperature.
Rinse the reservoir with 120 µL OPB once.
Ensure Transformer temperature has reached 58° C
Prepare sequencing solution using the worksheet.
Mix the solution thoroughly by vortexing and spinning. Tap the tube with fingers to remove any bubbles.
Carefully add the solution to reservoir avoiding any bubbles.
Load the reservoir on the Transformer.
Set a timer for 10 minutes for the first cycle incorporation.
After 10 minutes, manually adjust the focus for each wavelength:
In the manual controls, select a filter and pulse time and then start the preview.
Use the focus adjustment buttons to bring the clusters in focus.
Stop the preview.
Verify that all other wavelengths are in focus by repeating steps 13.1 and 13.3 for each wavelength. It should not be necessary to refocus any wavelength.