Sequencing
Introduction
Traditional Sequencing By Synthesis technologies typically involve separate incorporation, washing, imaging, and cleavage steps with continuous feeding of multiple buffers. 454 Bio’s One Pot sequencing on the LED-TIRF based Transformer only needs one solution without any fluid exchange for imaging, washing, or cleaving steps.
![](/docs/protocols/sequencing/LED-TIRFOnePot_hubdd49ce562237890b9f32cea3f2dd6ad_686982_640x0_resize_catmullrom_3.png)
One Pot Sequencing on the LED-TIRF Transformer takes place at a constant temperature of 58 C. A cycle of sequencing consists of a 10 minute incubation to allow for Lightning Terminator incorporation. Next, the 4 visible wavelength LEDs are pulsed to excite each Lightning Terminator. Images are captured in real time. After images are taken to record which base was incorporated, the Lightning Terminators™ are photocleaved by the UV LED. The linked dyes on incorporated Lightning Terminators™ are cleaved and diffuse away, allowing for the next base incorporation. This process is repeated for each cycle of sequencing.
![](/docs/protocols/sequencing/sequencingcycle_hu488afef27ec8c5caf174b3b1ffb3bea4_271577_640x0_resize_catmullrom_3.png)
This protocol describes the procedure to set up One Pot Sequencing on the LED-TIRF Transformer.
Revision History
Document | Version Number | Date | Description of Change |
---|---|---|---|
One pot Sequencing | V1.0 | Jan 2024 | Original JW |
Materials and Equipment
Item | Vendor | Cat. No |
---|---|---|
One pot buffer | 454 | Sequencing Buffer |
Lightning Terminator™ mix | 454 | shop |
DISCS | 454 | DISCS |
Therminator | NEB | M0261L |
Bst 3.0 | NEB | M0374L |
Reservoir | 454 | Make Consumables |
Sequencing Primer: ACACTCTTTCCCTACACGACGCTCTTCCGATC*T | IDT | Standard desalted lyophilized DNA oligo; 100 nmole minimum scale; * indicates phosphorothioated DNA bases |
Pipettes and tips (1000 µL, 200 µL, 20 µL, 2 µL) | various | n/a |
Vortex | various | n/a |
Microcentrifuge | various | n/a |
Transformer | 454 | Build Sequencer |
Notes before starting
Lightning Terminators™ need to be carefully handled and only exposed to shorter than 500 nm light. Care should be taken to protect Lightning Terminators™ from photobleaching and from photocleaving due to exposure to light.
Procedure
- Open the sequencing setup worksheet.
- Enter the required information based on your experiment plan.
- Retrieve OPB buffer, Seq Primer, LTMix, DISCS from -20°C freezer and thaw them by leaving them on the bench for 30 minutes at room temperature.
- Pre-heat Transformer to 65°C.
- Seq Primer Hybridization:
- Prepare sequencing primer hybridization solution following the worksheet.
- Add 120 µL hybridization solution into the sequencing reservoir.
- Load the reservoir onto the pre-heated 454 Bio Transformer.
- Incubate reservoir at 65°C for 10 minutes.
- Bring the reservoir to the bench and incubate at room temperature for 10 minutes
- Set Transformer temperature to 58°C for sequencing.
- Rinse reservoir with 120 µL OPB once.
- Therminator Preloading:
- This step can be skipped if circular DISCS or RNA DISCS is used.
- Prepare Therminator solution following the worksheet.
- Add 60 µL Therminator solution into the reservoir.
- Incubate for 3 minutes at room temperature.
- Rinse the reservoir with 120 µL OPB once.
- Ensure Transformer temperature has reached 58° C
- Prepare sequencing solution using the worksheet.
- Mix the solution thoroughly by vortexing and spinning. Tap the tube with fingers to remove any bubbles.
- Carefully add the solution to reservoir avoiding any bubbles.
- Load the reservoir on the Transformer.
- Set a timer for 10 minutes for the first cycle incorporation.
- After 10 minutes, manually adjust the focus for each wavelength:
- In the manual controls, select a filter and pulse time and then start the preview.
- Use the focus adjustment buttons to bring the clusters in focus.
- Stop the preview.
- Verify that all other wavelengths are in focus by repeating steps 13.1 and 13.3 for each wavelength. It should not be necessary to refocus any wavelength.
- If any of the wavelengths are out of focus, calibrate your instrument’s focus before continuing.
- Repeat steps 13.1 to 13.3 for each wavelength After four wavelengths’ cluster images are all in focus, switch the focus pin to auto position.
- Start the protocol and one pot sequencing will automatically finish all desired cycles.